Mcduff Mcgruff Crypto Dog - Mix of Shiba Inu, French Bulldog, Corgi, Pitbull terrier, Border Collie, St. Bernard and Maltese

Achievements

None
Mcduff Mcgruff
Hey, Baby. I'm Mcduff Mcgruff. My favorite place to sleep is under the covers between my humans. I'm always up for some puppy action, is that wrong? I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I 'm here for something RUFF ;)
  • Purity 11%
  • Age 57 days
  • Racing Exp 0
  • Shiba Inu 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGTACGATCCAGCAGCGTACGATACTGAACC
G
T
A
G
T
A
C
G
A
T
C
C
A
G
C
A
G
C
G
T
A
C
G
A
T
A
C
T
G
A
A
C
C
Genes: EE9NOOE9JBK

Composition

Shiba Inu
27%
French Bulldog
18%
Corgi
18%
Pitbull terrier
9%
Border Collie
9%
St. Bernard
9%
Maltese
9%

Current Energy

Vitality -3 points
Lunar Effect +2 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs French Bulldog
Front Legs Pitbull terrier
Head Corgi
Ears Corgi
Snout Shiba Inu
Mouth French Bulldog
Nose Border Collie
Eyes St. Bernard
Color Maltese