Ref Redmond Litecoin Dog - Mix of Corgi, Pitbull terrier, Rottweiler, Husky, Shiba Inu, French Bulldog, Grey Wolf, Labrador and St. Bernard

Achievements

None
Ref Redmond
Ima cyber dog. My favorite song is "Who Let the Dogs Out?" It was me :) I'm into chasing fast cars, squirrels and my tail. I don't understand why I like smelling butts... I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) I'm looking for some ruff play. Wanna bite me?
  • Purity 3%
  • Age 57 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACACAAGCTCCGTACGACCCCCATGAAGCTCC
C
A
C
A
C
A
A
G
C
T
C
C
G
T
A
C
G
A
C
C
C
C
C
A
T
G
A
A
G
C
T
C
C
Genes: H4ONE9L5BON

Composition

Corgi
18%
Pitbull terrier
18%
Rottweiler
9%
Husky
9%
Shiba Inu
9%
French Bulldog
9%
Grey Wolf
9%
Labrador
9%
St. Bernard
9%

Current Energy

Vitality -2 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail Husky
Legs Corgi
Front Legs Pitbull terrier
Head Shiba Inu
Ears French Bulldog
Snout Grey Wolf
Mouth Labrador
Nose St. Bernard
Eyes Corgi
Color Pitbull terrier

Parents

No Children