Demi Data Cryptocurrency Game Dog - Mix of Husky, Rottweiler, Border Collie, Pug, German Shepard, Pitbull terrier and Golder Retriever

Achievements

None
Demi Data
How's it going? I'm Demi Data. Spiked dog collars really turn me on. Removing excess stuffing from pillows is my favorite hobby. I love barking all night when others try to sleep. If you have fleas or ticks, don't bother.
  • Purity 18%
  • Age 57 days
  • Racing Exp 0
  • Husky 45%
  • 0 races
  • Gen 8
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACACACATACGAATCAACATCCAGAACAACA
A
C
A
C
A
C
A
C
A
T
A
C
G
A
A
T
C
A
A
C
A
T
C
C
A
G
A
A
C
A
A
C
A
Genes: 4H4J274N844

Composition

Husky
45%
Rottweiler
9%
Border Collie
9%
Pug
9%
German Shepard
9%
Pitbull terrier
9%
Golder Retriever
9%

Current Energy

Vitality +14 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Rottweiler
Legs Husky
Front Legs Border Collie
Head Pug
Ears German Shepard
Snout Husky
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Husky
Color Husky

Parents

No Children