Piglet Purdy Crypto Dog - Mix of Rottweiler, Labrador BK, German Shepard, Pug, Poodle, Pitbull terrier and Yorkshire Terrier

Achievements

None
Piglet Purdy
I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! My favorite sport is catching treats my human throws! I enjoy chasing my tail around. I want someone who can show me a good time; I'll do the same for you.
  • Purity 7%
  • Age 4 months
  • Racing Exp 0
  • Rottweiler 27%
  • 0 races
  • Gen 5
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGCAGACTCCCACTTACACTCAGCATCACAC
G
A
A
G
C
A
G
A
C
T
C
C
C
A
C
T
T
A
C
A
C
T
C
A
G
C
A
T
C
A
C
A
C
Genes: 26INHFH767H

Composition

Rottweiler
27%
Labrador BK
18%
German Shepard
18%
Pug
9%
Poodle
9%
Pitbull terrier
9%
Yorkshire Terrier
9%

Current Energy

Vitality -54 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Labrador BK
Legs Poodle
Front Legs Pitbull terrier
Head Rottweiler
Ears Yorkshire Terrier
Snout Rottweiler
Mouth German Shepard
Nose Labrador BK
Eyes German Shepard
Color Rottweiler