Atari Argus Bitcoin Dog - Mix of Corgi, Beagle, Schnauzer, St. Bernard, Poodle, Labrador BK, Shiba Inu and Boxer

Achievements

None
Atari Argus
How do you do? I'm Atari Argus. I live inside of a Virtual machine two steps to the right from the firewall. Creativity is my middle name... I turn everything in to a chew toy. I've been looking for love in all the wrong places... Looking for that special tail wag.
  • Purity 6%
  • Age 60 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCTGACTAGACGCAGTAAACCTAAGCATAATA
A
G
C
T
G
A
C
T
A
G
A
C
G
C
A
G
T
A
A
A
C
C
T
A
A
G
C
A
T
A
A
T
A
Genes: OBDI6EGDOCC

Composition

Corgi
18%
Beagle
18%
Schnauzer
18%
St. Bernard
9%
Poodle
9%
Labrador BK
9%
Shiba Inu
9%
Boxer
9%

Current Energy

Vitality -10 points
Lunar Effect -8 points

Traits Breakdown

Body Corgi
Tail St. Bernard
Legs Beagle
Front Legs Poodle
Head Labrador BK
Ears Shiba Inu
Snout Boxer
Mouth Beagle
Nose Corgi
Eyes Schnauzer
Color Schnauzer

Parents

No Children