Athena Ace Litecoin Dog - Mix of German Shepard, Pitbull terrier, Border Collie, Shiba Inu, Yorkshire Terrier and Corgi

Achievements

None
Athena Ace
Greetings. My name is Athena Ace. I'm into group dog piles, the more the better. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I'm not looking to hook up forever, just to have a little fun.
  • Purity 20%
  • Age 60 days
  • Racing Exp 0
  • German Shepard 45%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATACTCATCCGTATCATCCTTAAGC
T
C
A
T
C
A
T
C
A
T
A
C
T
C
A
T
C
C
G
T
A
T
C
A
T
C
C
T
T
A
A
G
C
Genes: 777J7NE7NFO

Composition

German Shepard
45%
Pitbull terrier
18%
Border Collie
9%
Shiba Inu
9%
Yorkshire Terrier
9%
Corgi
9%

Current Energy

Vitality +29 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs Border Collie
Head German Shepard
Ears Pitbull terrier
Snout Shiba Inu
Mouth German Shepard
Nose Pitbull terrier
Eyes Yorkshire Terrier
Color Corgi