Codex Chompers Digital Cryptocurrency Dog - Mix of Rottweiler, Boxer, Yorkshire Terrier, Corgi, Pitbull terrier, Golder Retriever and Labrador

Achievements

None
Codex Chompers
Ima cyber dog. I'm always up for some puppy action, is that wrong? I enjoy chasing my tail around. Power outages and computer viruses scare me! My favorite sport is catching treats my human throws! I'm looking for someone to make bath time a little more bearable!
  • Purity 18%
  • Age 60 days
  • Racing Exp 0
  • Rottweiler 45%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACTTACACAGCCACCACTCCCACCACAGACCA
A
A
C
T
T
A
C
A
C
A
G
C
C
A
C
C
A
C
T
C
C
C
A
C
C
A
C
A
G
A
C
C
A
Genes: GFHOHHNHH85

Composition

Rottweiler
45%
Boxer
9%
Yorkshire Terrier
9%
Corgi
9%
Pitbull terrier
9%
Golder Retriever
9%
Labrador
9%

Current Energy

Vitality -3 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Yorkshire Terrier
Legs Rottweiler
Front Legs Corgi
Head Rottweiler
Ears Rottweiler
Snout Pitbull terrier
Mouth Rottweiler
Nose Rottweiler
Eyes Golder Retriever
Color Labrador

Parents

No Children