Augie April Litecoin Dog - Mix of Rottweiler, Boxer, Yorkshire Terrier, Corgi, Husky, Golder Retriever and Poodle

Achievements

None
Augie April
How do you do? I'm Augie April. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I am looking for my best friend, lover, and equal partner to share my food bowl.
  • Purity 18%
  • Age 60 days
  • Racing Exp 0
  • Rottweiler 45%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACTTACACAGCCACCACACACACCACAGAGAC
A
A
C
T
T
A
C
A
C
A
G
C
C
A
C
C
A
C
A
C
A
C
A
C
C
A
C
A
G
A
G
A
C
Genes: GFHOHH4HH8I

Composition

Rottweiler
45%
Boxer
9%
Yorkshire Terrier
9%
Corgi
9%
Husky
9%
Golder Retriever
9%
Poodle
9%

Current Energy

Vitality -3 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Yorkshire Terrier
Legs Rottweiler
Front Legs Corgi
Head Rottweiler
Ears Rottweiler
Snout Husky
Mouth Rottweiler
Nose Rottweiler
Eyes Golder Retriever
Color Poodle

Parents

No Children