Monster Man Mary Jane Litecoin Dog - Mix of Rottweiler, Boxer, Grey Wolf, Maltese, Labrador, Husky, French Bulldog, Pitbull terrier and Shiba Inu

Achievements

None
Monster Man Mary Jane
Chasing anything that will run is so much fun, I could do that all day. I'd like to help you shed your coat, baby. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect!
  • Purity 6%
  • Age 60 days
  • Racing Exp 0
  • Rottweiler 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACCCCACCCCAACACGACACTCCGTACACCAC
A
A
C
C
C
C
A
C
C
C
C
A
A
C
A
C
G
A
C
A
C
T
C
C
G
T
A
C
A
C
C
A
C
Genes: GLK549HNEHH

Composition

Rottweiler
27%
Boxer
9%
Grey Wolf
9%
Maltese
9%
Labrador
9%
Husky
9%
French Bulldog
9%
Pitbull terrier
9%
Shiba Inu
9%

Current Energy

Vitality -4 points
Lunar Effect -8 points

Traits Breakdown

Body Boxer
Tail Grey Wolf
Legs Maltese
Front Legs Labrador
Head Husky
Ears French Bulldog
Snout Rottweiler
Mouth Pitbull terrier
Nose Shiba Inu
Eyes Rottweiler
Color Rottweiler

Parents

No Children