Bingo Bubba Bitcoin Dog - Mix of Maltese, Labrador, Border Collie, Rottweiler, German Shepard, Husky and Schnauzer

Achievements

None
Bingo Bubba
Barkjour mi amor! I'm Bingo Bubba. I hate being left alone all day. Oh, go ahead. Pet me. I know you want to. It doesn't matter to me which team I play for... I just like tail. My favorite song is "Who Let the Dogs Out?" It was me :) I want someone who can show me a good time; I'll do the same for you.
  • Purity 9%
  • Age 57 days
  • Racing Exp 0
  • Maltese 27%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCACACTACCCATCAACCACAATAACCACCTAC
C
C
A
C
A
C
T
A
C
C
C
A
T
C
A
A
C
C
A
C
A
A
T
A
A
C
C
A
C
C
T
A
C
Genes: 5HJ57K4CKKJ

Composition

Maltese
27%
Labrador
18%
Border Collie
18%
Rottweiler
9%
German Shepard
9%
Husky
9%
Schnauzer
9%

Current Energy

Vitality +34 points
Lunar Effect +12 points

Traits Breakdown

Body Labrador
Tail Rottweiler
Legs Border Collie
Front Legs Labrador
Head German Shepard
Ears Maltese
Snout Husky
Mouth Schnauzer
Nose Maltese
Eyes Maltese
Color Border Collie