Lollipop Lucifer Litecoin Dog - Mix of Shiba Inu, Maltese, Corgi, German Shepard, Labrador BK, Husky and Labrador

Achievements

None
Lollipop Lucifer
Too much steak gives me the runs! I could spend days on end chasing my tail. I get so close but it's just so fast! Peanut butter is delish but I HATE when it sticks to the roof of my mouth. Finding the 'one' out of the pack that I can spend my life with...that's what I want.
  • Purity 20%
  • Age 60 days
  • Racing Exp 0
  • Shiba Inu 45%
  • 0 races
  • Gen 8
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGTAACCAGCTCAGCAGTAACACCAGTAGTA
G
T
A
G
T
A
A
C
C
A
G
C
T
C
A
G
C
A
G
T
A
A
C
A
C
C
A
G
T
A
G
T
A
Genes: EEKO76E45EE

Composition

Shiba Inu
45%
Maltese
9%
Corgi
9%
German Shepard
9%
Labrador BK
9%
Husky
9%
Labrador
9%

Current Energy

Vitality -3 points
Lunar Effect -12 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Maltese
Front Legs Corgi
Head German Shepard
Ears Labrador BK
Snout Shiba Inu
Mouth Husky
Nose Labrador
Eyes Shiba Inu
Color Shiba Inu

Parents

No Children