Emily Esme Litecoin Game Dog - Mix of Corgi, Labrador BK, Schnauzer, Border Collie and Labrador

Achievements

None
Emily Esme
Chasing that damn Nyan Cat out into some web traffic on the information superhighway in #1 on my bucket list. I've always wanted to be in commercials and be treated as the star I am! I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 31%
  • Age 60 days
  • Racing Exp 0
  • Corgi 55%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAAGCATATACAGCAGCAGCCCAAGCAGCGCA
G
C
A
A
G
C
A
T
A
T
A
C
A
G
C
A
G
C
A
G
C
C
C
A
A
G
C
A
G
C
G
C
A
Genes: 6OCJOOO5OO6

Composition

Corgi
55%
Labrador BK
18%
Schnauzer
9%
Border Collie
9%
Labrador
9%

Current Energy

Vitality -1 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador BK
Tail Corgi
Legs Schnauzer
Front Legs Border Collie
Head Corgi
Ears Corgi
Snout Corgi
Mouth Labrador
Nose Corgi
Eyes Corgi
Color Labrador BK