Tiny Trinity Bitcoin Game Dog - Mix of Rottweiler, Labrador BK, Border Collie, Husky, Maltese and Pug

Achievements

None
Tiny Trinity
It's a barkin' beautiful day! Tiny Trinity here. I'm having some new data architecture built for me, then I'd like to have you over to my place. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew. I'm looking for some ruff play. Wanna bite me?
  • Purity 15%
  • Age 2 months
  • Racing Exp 0
  • Rottweiler 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACACAACCGCAGCAGAACACTACCACTACCAC
C
A
C
A
C
A
A
C
C
G
C
A
G
C
A
G
A
A
C
A
C
T
A
C
C
A
C
T
A
C
C
A
C
Genes: H4K662HJHJH

Composition

Rottweiler
36%
Labrador BK
18%
Border Collie
18%
Husky
9%
Maltese
9%
Pug
9%

Current Energy

Vitality -8 points
Lunar Effect +6 points

Traits Breakdown

Body Rottweiler
Tail Husky
Legs Maltese
Front Legs Labrador BK
Head Labrador BK
Ears Pug
Snout Rottweiler
Mouth Border Collie
Nose Rottweiler
Eyes Border Collie
Color Rottweiler