Arrow Accord Cryptocurrency Dog - Mix of Labrador BK, Border Collie, German Shepard, Dachshund, Maltese, Schnauzer, St. Bernard, Rottweiler and Pitbull terrier

Achievements

None
Arrow Accord
Top o' the mornin' to ya! I'm Arrow Accord. I make the best virtual pet. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I need to find someone tuff to help me protect our pups from that scheming mailman!
  • Purity 5%
  • Age 58 days
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGGAACCGCAGCATACATATGACACTACTCC
T
C
A
G
G
A
A
C
C
G
C
A
G
C
A
T
A
C
A
T
A
T
G
A
C
A
C
T
A
C
T
C
C
Genes: 7AK66JCBHJN

Composition

Labrador BK
18%
Border Collie
18%
German Shepard
9%
Dachshund
9%
Maltese
9%
Schnauzer
9%
St. Bernard
9%
Rottweiler
9%
Pitbull terrier
9%

Current Energy

Vitality +3 points
Lunar Effect +8 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs Maltese
Front Legs Labrador BK
Head Labrador BK
Ears Border Collie
Snout Schnauzer
Mouth St. Bernard
Nose Rottweiler
Eyes Border Collie
Color Pitbull terrier