Summer Squeakers Litecoin Game Dog - Mix of Maltese, Schnauzer, Dachshund, Labrador BK, Golder Retriever, St. Bernard, Poodle, Border Collie and Shiba Inu

Achievements

None
Summer Squeakers
I have a crush on the Grumpy cat. Eat, sleep, poop. Honey, I've got it made. I don't like having to stay off the furniture. I like it when you're frisky.
  • Purity 5%
  • Age 2 months
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCGGAACCGCAAGAATAATATGAGACTACGTA
A
C
C
G
G
A
A
C
C
G
C
A
A
G
A
A
T
A
A
T
A
T
G
A
G
A
C
T
A
C
G
T
A
Genes: KAK68CCBIJE

Composition

Maltese
18%
Schnauzer
18%
Dachshund
9%
Labrador BK
9%
Golder Retriever
9%
St. Bernard
9%
Poodle
9%
Border Collie
9%
Shiba Inu
9%

Current Energy

Vitality -29 points
Lunar Effect 0 points

Traits Breakdown

Body Maltese
Tail Dachshund
Legs Maltese
Front Legs Labrador BK
Head Golder Retriever
Ears Schnauzer
Snout Schnauzer
Mouth St. Bernard
Nose Poodle
Eyes Border Collie
Color Shiba Inu