Wyatt Wicket Cryptocurrency Game Dog - Mix of Labrador BK, Border Collie and Pitbull terrier

Achievements

None
Wyatt Wicket
Greetings. My name is Wyatt Wicket. I really dislike stinky flea collars. Little Bow Wow is my favorite musician. I just assume he's a dog... I am a proud show dog. I like showing off my perfect coat! It turns me on when I can show an older dog a new trick.
  • Purity 55%
  • Age 58 days
  • Racing Exp 0
  • Labrador BK 73%
  • 0 races
  • Gen 6
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGCAGCAGCATACTACGCAGCAGCAGCATCC
G
C
A
G
C
A
G
C
A
G
C
A
T
A
C
T
A
C
G
C
A
G
C
A
G
C
A
G
C
A
T
C
C
Genes: 6666JJ6666N

Composition

Labrador BK
73%
Border Collie
18%
Pitbull terrier
9%

Current Energy

Vitality +39 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Labrador BK
Legs Labrador BK
Front Legs Labrador BK
Head Border Collie
Ears Border Collie
Snout Labrador BK
Mouth Labrador BK
Nose Labrador BK
Eyes Labrador BK
Color Pitbull terrier

Parents

No Children