Jago Joy Litecoin Dog - Mix of Pug, Pitbull terrier, Border Collie, German Shepard, Husky and Rottweiler

Achievements

None
Jago Joy
The Ethernet where I live, rocks. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I've been looking for love in all the wrong places... My favorite thing is to sit in my humans' laps while they are trying to read or drive. I'm looking for someone who is also playful, feisty and happy.
  • Purity 20%
  • Age 2 months
  • Racing Exp 0
  • Pug 45%
  • 0 races
  • Gen 17
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTCCGAATCATCCGAAGAAGAAACAGAACAC
T
A
C
T
C
C
G
A
A
T
C
A
T
C
C
G
A
A
G
A
A
G
A
A
A
C
A
G
A
A
C
A
C
Genes: JN27N22242H

Composition

Pug
45%
Pitbull terrier
18%
Border Collie
9%
German Shepard
9%
Husky
9%
Rottweiler
9%

Current Energy

Vitality -1 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Pitbull terrier
Legs Pug
Front Legs German Shepard
Head Pitbull terrier
Ears Pug
Snout Pug
Mouth Pug
Nose Husky
Eyes Pug
Color Rottweiler

Parents

No Children