Beta Buffy Litecoin Dog - Mix of Labrador, Golder Retriever, Grey Wolf, Boxer, Pitbull terrier, Border Collie and Schnauzer

Achievements

Racer
Beta Buffy
I like exploring off leash best. I hate it when my humans fool me with a pill in peanut butter! If I can't reach it to clean it myself, it doesn't need cleaning! I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.
  • Purity 18%
  • Age 2 months
  • Racing Exp 7
  • Labrador 45%
  • 1 races
  • Gen 2
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
1 races    Best Time16.55 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAAGACCCCCACCACCAAACCCATCCTACATA
C
C
A
A
G
A
C
C
C
C
C
A
C
C
A
C
C
A
A
A
C
C
C
A
T
C
C
T
A
C
A
T
A
Genes: 58L555G5NJC

Composition

Labrador
45%
Golder Retriever
9%
Grey Wolf
9%
Boxer
9%
Pitbull terrier
9%
Border Collie
9%
Schnauzer
9%

Current Energy

Vitality +23 points
Lunar Effect -16 points

Traits Breakdown

Body Labrador
Tail Golder Retriever
Legs Grey Wolf
Front Legs Labrador
Head Labrador
Ears Labrador
Snout Boxer
Mouth Labrador
Nose Pitbull terrier
Eyes Border Collie
Color Schnauzer