Mia Mlem Cryptocurrency Dog - Mix of German Shepard, Poodle, Shiba Inu, Pug, Labrador BK, Border Collie, Husky, St. Bernard, Rottweiler, Yorkshire Terrier and Pitbull terrier

Achievements

None
Mia Mlem
I'm 100% digital, baby. If I can't reach it to clean it myself, it doesn't need cleaning! I believe running along the beach to catch a stick can be nearly orgasmic. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! If you are looking for companionship without commitment, keep looking.
  • Purity 0%
  • Age 2 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGACGTAGAAGCATACACATGACACTTATCC
T
C
A
G
A
C
G
T
A
G
A
A
G
C
A
T
A
C
A
C
A
T
G
A
C
A
C
T
T
A
T
C
C
Genes: 7IE26J4BHFN

Composition

German Shepard
9%
Poodle
9%
Shiba Inu
9%
Pug
9%
Labrador BK
9%
Border Collie
9%
Husky
9%
St. Bernard
9%
Rottweiler
9%
Yorkshire Terrier
9%
Pitbull terrier
9%

Current Energy

Vitality -9 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail Poodle
Legs Shiba Inu
Front Legs Pug
Head Labrador BK
Ears Border Collie
Snout Husky
Mouth St. Bernard
Nose Rottweiler
Eyes Yorkshire Terrier
Color Pitbull terrier