Ashes April Digital Cryptocurrency Dog - Mix of Corgi, Labrador, Maltese and Pitbull terrier

Achievements

None
Ashes April
Hello, there. Ashes April here. The smell of fresh manure to roll in makes me wild. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... I don't appreciate being around bores who bark too much.
  • Purity 37%
  • Age 60 days
  • Racing Exp 0
  • Corgi 55%
  • 0 races
  • Gen 14
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCACCAAGCAGCAGCAGCAGCAGCCCAACCTCC
C
C
A
C
C
A
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
C
C
A
A
C
C
T
C
C
Genes: 55OOOOOO5KN

Composition

Corgi
55%
Labrador
27%
Maltese
9%
Pitbull terrier
9%

Current Energy

Vitality +2 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs Corgi
Front Legs Corgi
Head Corgi
Ears Corgi
Snout Corgi
Mouth Corgi
Nose Labrador
Eyes Maltese
Color Pitbull terrier

Parents

No Children