Tango Triumph Bitcoin Dog - Mix of St. Bernard, Maltese, Yorkshire Terrier, Corgi, Pitbull terrier, Beagle, Pug and Labrador

Achievements

None
Tango Triumph
Hi! My name is Tango Triumph. Nyan Cat is my best friend here in the cyberspace. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from?? I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.
  • Purity 8%
  • Age 60 days
  • Racing Exp 0
  • St. Bernard 27%
  • 0 races
  • Gen 4
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGATTATGAACCACCTGAAGCTCCCTAGAACCA
T
G
A
T
T
A
T
G
A
A
C
C
A
C
C
T
G
A
A
G
C
T
C
C
C
T
A
G
A
A
C
C
A
Genes: BFBKKBOND25

Composition

St. Bernard
27%
Maltese
18%
Yorkshire Terrier
9%
Corgi
9%
Pitbull terrier
9%
Beagle
9%
Pug
9%
Labrador
9%

Current Energy

Vitality -25 points
Lunar Effect +14 points

Traits Breakdown

Body St. Bernard
Tail Yorkshire Terrier
Legs St. Bernard
Front Legs Maltese
Head Maltese
Ears St. Bernard
Snout Corgi
Mouth Pitbull terrier
Nose Beagle
Eyes Pug
Color Labrador

Parents

No Children