Bebe Barney Crypto Game Dog - Mix of Labrador BK, Dachshund, Boxer, Schnauzer, Pitbull terrier, Beagle, St. Bernard, Husky, Rottweiler, German Shepard and Shiba Inu

Achievements

None
Bebe Barney
Top o' the mornin' to ya! I'm Bebe Barney. Virtually, I'll come whenever you call. I've been known to run with bad dogs. I believe running along the beach to catch a stick can be nearly orgasmic. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?!
  • Purity 0%
  • Age 2 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGGAAACATATCCCTATGAACACACTCAGTA
G
C
A
G
G
A
A
A
C
A
T
A
T
C
C
C
T
A
T
G
A
A
C
A
C
A
C
T
C
A
G
T
A
Genes: 6AGCNDB4H7E

Composition

Labrador BK
9%
Dachshund
9%
Boxer
9%
Schnauzer
9%
Pitbull terrier
9%
Beagle
9%
St. Bernard
9%
Husky
9%
Rottweiler
9%
German Shepard
9%
Shiba Inu
9%

Current Energy

Vitality -9 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail Dachshund
Legs Boxer
Front Legs Schnauzer
Head Pitbull terrier
Ears Beagle
Snout St. Bernard
Mouth Husky
Nose Rottweiler
Eyes German Shepard
Color Shiba Inu

Parents

No Children