Bella Bimmer Cryptocurrency Dog - Pure Labrador BK

Achievements

None
Bella Bimmer
Bella Bimmer here, let's shake. I cry whenever I hear an ambulance siren! I'm into recreational spankings and a little 'ruff' play. I hate it when humans put the lid down. I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.
  • Purity 100%
  • Age 2 months
  • Racing Exp 0
  • Labrador BK 100%
  • 0 races
  • Gen 7
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
Genes: 66666666666

Composition

Labrador BK
100%

Current Energy

Vitality +3 points
Lunar Effect -24 points

Traits Breakdown

Traits 100% Purebred Labrador BK