Damon Dawson Litecoin Game Dog - Mix of German Shepard, Labrador, Rottweiler, Pug, Yorkshire Terrier and Schnauzer

Achievements

None
Damon Dawson
As a digital dog, let me say Bob Dole did not invent the internet. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! Hound Dog by Elvis is probably the best song ever written.
  • Purity 13%
  • Age 60 days
  • Racing Exp 0
  • German Shepard 36%
  • 0 races
  • Gen 12
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCATCACCAGAATCATTACACTCATCACACATA
C
C
A
T
C
A
C
C
A
G
A
A
T
C
A
T
T
A
C
A
C
T
C
A
T
C
A
C
A
C
A
T
A
Genes: 57527FH77HC

Composition

German Shepard
36%
Labrador
18%
Rottweiler
18%
Pug
9%
Yorkshire Terrier
9%
Schnauzer
9%

Current Energy

Vitality +6 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail German Shepard
Legs Labrador
Front Legs Pug
Head German Shepard
Ears Yorkshire Terrier
Snout Rottweiler
Mouth German Shepard
Nose German Shepard
Eyes Rottweiler
Color Schnauzer