Ashes Adella Litecoin Dog - Mix of German Shepard, Grey Wolf, Husky, Golder Retriever, Schnauzer, Border Collie, Shiba Inu and Labrador BK

Achievements

None
Ashes Adella
Don't bother contacting me if you like cats. Steak is my absolute favorite, but I prefer to eat chicken for my health. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. When my human brushes my coat, I get frisky!
  • Purity 6%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 14
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAACAAGACCCTCAATATACTCAGTACCCGCA
T
C
A
A
C
A
A
G
A
C
C
C
T
C
A
A
T
A
T
A
C
T
C
A
G
T
A
C
C
C
G
C
A
Genes: 748L7CJ7EL6

Composition

German Shepard
27%
Grey Wolf
18%
Husky
9%
Golder Retriever
9%
Schnauzer
9%
Border Collie
9%
Shiba Inu
9%
Labrador BK
9%

Current Energy

Vitality +19 points
Lunar Effect -18 points

Traits Breakdown

Body German Shepard
Tail Husky
Legs Golder Retriever
Front Legs Grey Wolf
Head German Shepard
Ears Schnauzer
Snout Border Collie
Mouth German Shepard
Nose Shiba Inu
Eyes Grey Wolf
Color Labrador BK