Adele Ariel Crypto Game Dog - Mix of Grey Wolf, Border Collie, Corgi, Pitbull terrier and Schnauzer

Achievements

None
Adele Ariel
The internet's my home. You'll find me walking into my favorite pet store like I own the place. I do, don't I? I'm willing to try little bondage, so my human chained me up! I'm into recreational spankings and a little 'ruff' play. I hate never catching that damn rabbit in my dreams.
  • Purity 27%
  • Age 60 days
  • Racing Exp 0
  • Grey Wolf 55%
  • 0 races
  • Gen 17
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACAGCCCCCCCTACCCCCCCTCCCCCATACCC
T
A
C
A
G
C
C
C
C
C
C
C
T
A
C
C
C
C
C
C
C
T
C
C
C
C
C
A
T
A
C
C
C
Genes: JOLLJLLNLCL

Composition

Grey Wolf
55%
Border Collie
18%
Corgi
9%
Pitbull terrier
9%
Schnauzer
9%

Current Energy

Vitality +25 points
Lunar Effect -10 points

Traits Breakdown

Body Border Collie
Tail Corgi
Legs Grey Wolf
Front Legs Grey Wolf
Head Border Collie
Ears Grey Wolf
Snout Grey Wolf
Mouth Pitbull terrier
Nose Grey Wolf
Eyes Schnauzer
Color Grey Wolf