Ruffer Raven Litecoin Game Dog - Mix of Grey Wolf, German Shepard, Labrador BK, Maltese and Boxer

Achievements

Racer
TOP 10 Fastest
Ruffer Raven
Are you into garbage cans? I am. I hate hiding under the bed during a thunder storm but that's just smart, right? In my humble opinion the best toy is one of my human's stinky, old socks. I never met a leg I didn't want to hump.
  • Purity 15%
  • Age 2 months
  • Racing Exp 6
  • Grey Wolf 36%
  • 1 races
  • Gen 9
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
1 races    Best Time15.13 sec
Rank 8  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACCCGCATCAACCAACCCCCCCGCACCCACC
T
C
A
C
C
C
G
C
A
T
C
A
A
C
C
A
A
C
C
C
C
C
C
C
G
C
A
C
C
C
A
C
C
Genes: 7L67KGLL6LK

Composition

Grey Wolf
36%
German Shepard
18%
Labrador BK
18%
Maltese
18%
Boxer
9%

Current Energy

Vitality +9 points
Lunar Effect -22 points

Traits Breakdown

Body German Shepard
Tail Grey Wolf
Legs Labrador BK
Front Legs German Shepard
Head Maltese
Ears Boxer
Snout Grey Wolf
Mouth Grey Wolf
Nose Labrador BK
Eyes Grey Wolf
Color Maltese