Happyt Hot Box Cryptocurrency Game Dog - Pure Labrador BK

Achievements

First Pure Breed Dog
Racer
Happyt Hot Box
Hey! Call me Happyt Hot Box. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. Blue toilet water turns me off. I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.
  • Purity 100%
  • Age 2 months
  • Racing Exp 30
  • Labrador BK 100%
  • 5 races
  • Gen 6
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 1 3 0
5 races    Best Time14.67 sec
No rank  Racing *** Coins
80.0 % wins (4) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
Genes: 66666666666

Composition

Labrador BK
100%

Current Energy

Vitality +5 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred Labrador BK