Shasta Sinker Cryptocurrency Dog - Mix of Grey Wolf, Border Collie, Shiba Inu, Pitbull terrier and Schnauzer

Achievements

None
Shasta Sinker
As a digital dog, let me say Bob Dole did not invent the internet. Sometimes I forget where I buried my bone. In my humble opinion the best toy is one of my human's stinky, old socks. Aggressive dogs that don't let 'me be me' frustrate me. I enjoy staying active, and running circles around puppies and young children.
  • Purity 36%
  • Age 14 months
  • Racing Exp 0
  • Grey Wolf 64%
  • 0 races
  • Gen 16
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACCCCCCCCCCGTACCCCCCTCCCCCATACCC
T
A
C
C
C
C
C
C
C
C
C
C
G
T
A
C
C
C
C
C
C
T
C
C
C
C
C
A
T
A
C
C
C
Genes: JLLLELLNLCL

Composition

Grey Wolf
64%
Border Collie
9%
Shiba Inu
9%
Pitbull terrier
9%
Schnauzer
9%

Current Energy

Vitality -13 points
Lunar Effect -20 points

Traits Breakdown

Body Border Collie
Tail Grey Wolf
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Grey Wolf
Snout Grey Wolf
Mouth Pitbull terrier
Nose Grey Wolf
Eyes Schnauzer
Color Grey Wolf