Tommy Tobie Litecoin Dog - Mix of Husky, Pitbull terrier, Labrador, Pug, Golder Retriever, Beagle, French Bulldog, Maltese, Shiba Inu, Schnauzer and Yorkshire Terrier

Achievements

None
Tommy Tobie
Hey there! Baby, call me Tommy Tobie. What's your favorite bed? Mine is the dirty laundry. I hate never catching that damn rabbit in my dreams. I've been known to run with bad dogs. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... New experiences? New treats? New places! Yes, please!
  • Purity 0%
  • Age 2 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATCCCCAGAAAGACTACGAACCGTAATATTA
A
C
A
T
C
C
C
C
A
G
A
A
A
G
A
C
T
A
C
G
A
A
C
C
G
T
A
A
T
A
T
T
A
Genes: 4N528D9KECF

Composition

Husky
9%
Pitbull terrier
9%
Labrador
9%
Pug
9%
Golder Retriever
9%
Beagle
9%
French Bulldog
9%
Maltese
9%
Shiba Inu
9%
Schnauzer
9%
Yorkshire Terrier
9%

Current Energy

Vitality -5 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Pitbull terrier
Legs Labrador
Front Legs Pug
Head Golder Retriever
Ears Beagle
Snout French Bulldog
Mouth Maltese
Nose Shiba Inu
Eyes Schnauzer
Color Yorkshire Terrier

Parents

No Children