Mr Kitty Motaro Crypto Dog - Mix of Corgi, French Bulldog, St. Bernard, Rottweiler, Golder Retriever, Labrador BK, Maltese, Beagle, Schnauzer, Yorkshire Terrier and Labrador

Achievements

None
Mr Kitty Motaro
How you doin? ;) Mr Kitty Motaro here. Currently, I live on the information superhighway. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).
  • Purity 0%
  • Age 2 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCCGATGACACAGAGCAACCCTAATATTACCA
A
G
C
C
G
A
T
G
A
C
A
C
A
G
A
G
C
A
A
C
C
C
T
A
A
T
A
T
T
A
C
C
A
Genes: O9BH86KDCF5

Composition

Corgi
9%
French Bulldog
9%
St. Bernard
9%
Rottweiler
9%
Golder Retriever
9%
Labrador BK
9%
Maltese
9%
Beagle
9%
Schnauzer
9%
Yorkshire Terrier
9%
Labrador
9%

Current Energy

Vitality -8 points
Lunar Effect +4 points

Traits Breakdown

Body Corgi
Tail French Bulldog
Legs St. Bernard
Front Legs Rottweiler
Head Golder Retriever
Ears Labrador BK
Snout Maltese
Mouth Beagle
Nose Schnauzer
Eyes Yorkshire Terrier
Color Labrador

Parents

No Children