Mork Mini Bitcoin Dog - Mix of German Shepard, St. Bernard, Maltese, Grey Wolf, French Bulldog, Pitbull terrier, Labrador BK and Border Collie

Achievements

None
Mork Mini
I am a guard dog for the data warehouse. I like to respond to sad puppy eyes with sad puppy eyes of my own. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I love car rides when I can stick my head out the window.
  • Purity 9%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAACCCCCTCATGATGACGATCCGCATACTCA
T
C
A
A
C
C
C
C
C
T
C
A
T
G
A
T
G
A
C
G
A
T
C
C
G
C
A
T
A
C
T
C
A
Genes: 7KL7BB9N6J7

Composition

German Shepard
27%
St. Bernard
18%
Maltese
9%
Grey Wolf
9%
French Bulldog
9%
Pitbull terrier
9%
Labrador BK
9%
Border Collie
9%

Current Energy

Vitality +34 points
Lunar Effect -12 points

Traits Breakdown

Body German Shepard
Tail Maltese
Legs Grey Wolf
Front Legs German Shepard
Head St. Bernard
Ears St. Bernard
Snout French Bulldog
Mouth Pitbull terrier
Nose Labrador BK
Eyes Border Collie
Color German Shepard