Touchdown Tiki Crypto Game Dog - Mix of Maltese, Schnauzer, Beagle, Husky, French Bulldog, Labrador BK, Shiba Inu, Corgi, Pitbull terrier, Boxer and Labrador

Achievements

None
Touchdown Tiki
Touchdown Tiki here, let's shake. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I love it when you show a little teeth. I am really into starting howling wars with the neighborhood dogs. I'm the loudest! You know the worst? Watching my humans 'get it on' when I've got no one.
  • Purity 0%
  • Age 2 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCATACTAACACGAGCAGTAAGCTCCAACCCA
A
C
C
A
T
A
C
T
A
A
C
A
C
G
A
G
C
A
G
T
A
A
G
C
T
C
C
A
A
C
C
C
A
Genes: KCD496EONG5

Composition

Maltese
9%
Schnauzer
9%
Beagle
9%
Husky
9%
French Bulldog
9%
Labrador BK
9%
Shiba Inu
9%
Corgi
9%
Pitbull terrier
9%
Boxer
9%
Labrador
9%

Current Energy

Vitality -12 points
Lunar Effect +4 points

Traits Breakdown

Body Maltese
Tail Schnauzer
Legs Beagle
Front Legs Husky
Head French Bulldog
Ears Labrador BK
Snout Shiba Inu
Mouth Corgi
Nose Pitbull terrier
Eyes Boxer
Color Labrador