Zeus Zip Bitcoin Dog - Mix of St. Bernard, Husky, Pug, Beagle, Golder Retriever and Labrador BK

Achievements

None
Zeus Zip
Someday I'm gonna breakout from inside this server. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! I'm looking for a hard-working service animal who can keep up with me.
  • Purity 27%
  • Age 2 months
  • Racing Exp 0
  • St. Bernard 55%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGAACTATGATGAAGATGATGAGCATGATGA
A
C
A
G
A
A
C
T
A
T
G
A
T
G
A
A
G
A
T
G
A
T
G
A
G
C
A
T
G
A
T
G
A
Genes: 42DBB8BB6BB

Composition

St. Bernard
55%
Husky
9%
Pug
9%
Beagle
9%
Golder Retriever
9%
Labrador BK
9%

Current Energy

Vitality +4 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Pug
Legs Beagle
Front Legs St. Bernard
Head St. Bernard
Ears Golder Retriever
Snout St. Bernard
Mouth St. Bernard
Nose Labrador BK
Eyes St. Bernard
Color St. Bernard