Patty Punky Cryptocurrency Game Dog - Mix of German Shepard, Grey Wolf, Border Collie, Rottweiler, Yorkshire Terrier, Boxer and Labrador BK

Achievements

None
Patty Punky
Hullo. My name is Patty Punky. I like to work out by digging fresh holes in landscaped yards. In my humble opinion the best toy is one of my human's stinky, old socks. I'm going kill that damn Nyan Cat if I can catch it. Don't bother contacting me if you like cats.
  • Purity 12%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 36%
  • 0 races
  • Gen 14
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTCACCCCACTCATCACCCTCATTAAACGCA
T
A
C
T
C
A
C
C
C
C
A
C
T
C
A
T
C
A
C
C
C
T
C
A
T
T
A
A
A
C
G
C
A
Genes: J7LH77L7FG6

Composition

German Shepard
36%
Grey Wolf
18%
Border Collie
9%
Rottweiler
9%
Yorkshire Terrier
9%
Boxer
9%
Labrador BK
9%

Current Energy

Vitality +9 points
Lunar Effect -16 points

Traits Breakdown

Body Border Collie
Tail German Shepard
Legs Grey Wolf
Front Legs Rottweiler
Head German Shepard
Ears German Shepard
Snout Grey Wolf
Mouth German Shepard
Nose Yorkshire Terrier
Eyes Boxer
Color Labrador BK

Parents

No Children