Alf Alfred Litecoin Dog - Mix of Beagle, St. Bernard, Boxer, Dachshund, Pug, Schnauzer, Yorkshire Terrier, French Bulldog, Pitbull terrier, Poodle and Shiba Inu

Achievements

None
Alf Alfred
Sup? ;-) I'm Alf Alfred. I'm all about a hard drive because you can't do anything with a floppy disc. You'll find me walking into my favorite pet store like I own the place. I do, don't I? I hate never catching that damn rabbit in my dreams. I need laid otherwise I'm going to start agreeing with Grumpy Cat.
  • Purity 0%
  • Age 2 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATGAAACGGAGAAATATTACGATCCGACGTA
C
T
A
T
G
A
A
A
C
G
G
A
G
A
A
A
T
A
T
T
A
C
G
A
T
C
C
G
A
C
G
T
A
Genes: DBGA2CF9NIE

Composition

Beagle
9%
St. Bernard
9%
Boxer
9%
Dachshund
9%
Pug
9%
Schnauzer
9%
Yorkshire Terrier
9%
French Bulldog
9%
Pitbull terrier
9%
Poodle
9%
Shiba Inu
9%

Current Energy

Vitality -16 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail St. Bernard
Legs Boxer
Front Legs Dachshund
Head Pug
Ears Schnauzer
Snout Yorkshire Terrier
Mouth French Bulldog
Nose Pitbull terrier
Eyes Poodle
Color Shiba Inu

Parents

No Children