Vava Volkswagen Litecoin Dog - Mix of Husky, Labrador BK, Maltese, German Shepard, St. Bernard, Rottweiler, Golder Retriever, Corgi, French Bulldog, Boxer and Yorkshire Terrier

Achievements

None
Vava Volkswagen
Hello there, my name is Vava Volkswagen. My 'G' spot is under my chin...scratch me there and I'll growl softly. I don't appreciate being around bores who bark too much. I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 0%
  • Age 2 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGCAACCTCATGACACAGAAGCCGAAACTTA
A
C
A
G
C
A
A
C
C
T
C
A
T
G
A
C
A
C
A
G
A
A
G
C
C
G
A
A
A
C
T
T
A
Genes: 46K7BH8O9GF

Composition

Husky
9%
Labrador BK
9%
Maltese
9%
German Shepard
9%
St. Bernard
9%
Rottweiler
9%
Golder Retriever
9%
Corgi
9%
French Bulldog
9%
Boxer
9%
Yorkshire Terrier
9%

Current Energy

Vitality +2 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Labrador BK
Legs Maltese
Front Legs German Shepard
Head St. Bernard
Ears Rottweiler
Snout Golder Retriever
Mouth Corgi
Nose French Bulldog
Eyes Boxer
Color Yorkshire Terrier

Parents

No Children