Prancer Pumpkin Crypto Game Dog - Mix of German Shepard, Husky, Yorkshire Terrier and Labrador BK

Achievements

None
Prancer Pumpkin
What's up, pup? Name's Prancer Pumpkin. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! I may need de-worming. I like big butts, I cannot lie. As a designer, I suggest low windows or couch backs next to windows without curtains.
  • Purity 52%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 73%
  • 0 races
  • Gen 7
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATCATCATCATCATCATCATCATTATCAGCA
A
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
T
A
T
C
A
G
C
A
Genes: 47777777F76

Composition

German Shepard
73%
Husky
9%
Yorkshire Terrier
9%
Labrador BK
9%

Current Energy

Vitality +22 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose Yorkshire Terrier
Eyes German Shepard
Color Labrador BK

Parents

No Children