Lark Little-Guy Bitcoin Dog - Mix of Labrador BK, German Shepard, Yorkshire Terrier, Schnauzer, Shiba Inu, French Bulldog, Golder Retriever, St. Bernard, Border Collie, Rottweiler and Husky

Achievements

None
Lark Little-Guy
I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! Spiked dog collars really turn me on. I love cuddling up, doggy-style after a romantic evening.
  • Purity 0%
  • Age 2 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCATCATTAATAGTACGAAGATGATACCACACA
G
C
A
T
C
A
T
T
A
A
T
A
G
T
A
C
G
A
A
G
A
T
G
A
T
A
C
C
A
C
A
C
A
Genes: 67FCE98BJH4

Composition

Labrador BK
9%
German Shepard
9%
Yorkshire Terrier
9%
Schnauzer
9%
Shiba Inu
9%
French Bulldog
9%
Golder Retriever
9%
St. Bernard
9%
Border Collie
9%
Rottweiler
9%
Husky
9%

Current Energy

Vitality -2 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail German Shepard
Legs Yorkshire Terrier
Front Legs Schnauzer
Head Shiba Inu
Ears French Bulldog
Snout Golder Retriever
Mouth St. Bernard
Nose Border Collie
Eyes Rottweiler
Color Husky

Parents

No Children