Mitzi Mowgli Crypto Dog - Mix of Labrador BK, Boxer and Maltese

Achievements

None
Mitzi Mowgli
Hi, Mitzi Mowgli is my name. In the big data server, I sorta rule. I don't like running outta pee when there are still so many trees. I like it when you're frisky. Chasing anything that will run is so much fun, I could do that all day. I pee when I'm excited.
  • Purity 65%
  • Age 2 months
  • Racing Exp 0
  • Labrador BK 82%
  • 0 races
  • Gen 5
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGCAGCAGCAGCAAACGCAGCAGCAGCAACC
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
A
A
C
G
C
A
G
C
A
G
C
A
G
C
A
A
C
C
Genes: 66666G6666K

Composition

Labrador BK
82%
Boxer
9%
Maltese
9%

Current Energy

Vitality -5 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Labrador BK
Legs Labrador BK
Front Legs Labrador BK
Head Labrador BK
Ears Boxer
Snout Labrador BK
Mouth Labrador BK
Nose Labrador BK
Eyes Labrador BK
Color Maltese