Joe Jak Bitcoin Dog - Mix of Dachshund, Pitbull terrier, Rottweiler, Yorkshire Terrier, Poodle, German Shepard, Border Collie, St. Bernard, Husky, Labrador and Maltese

Achievements

None
Joe Jak
I'm not a bad dog, my data is just configured that way. Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I hate it when I am not the center of attention. I'm not looking to hook up forever, just to have a little fun.
  • Purity 0%
  • Age 2 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGATCCCACTTAGACTCATACTGAACACCAACC
G
G
A
T
C
C
C
A
C
T
T
A
G
A
C
T
C
A
T
A
C
T
G
A
A
C
A
C
C
A
A
C
C
Genes: ANHFI7JB45K

Composition

Dachshund
9%
Pitbull terrier
9%
Rottweiler
9%
Yorkshire Terrier
9%
Poodle
9%
German Shepard
9%
Border Collie
9%
St. Bernard
9%
Husky
9%
Labrador
9%
Maltese
9%

Current Energy

Vitality -12 points
Lunar Effect -8 points

Traits Breakdown

Body Dachshund
Tail Pitbull terrier
Legs Rottweiler
Front Legs Yorkshire Terrier
Head Poodle
Ears German Shepard
Snout Border Collie
Mouth St. Bernard
Nose Husky
Eyes Labrador
Color Maltese

Parents

No Children