Pascal Presley Crypto Dog - Mix of Yorkshire Terrier, Border Collie, Pug, Corgi, Shiba Inu, German Shepard, Pitbull terrier, Schnauzer, St. Bernard, Dachshund and Labrador

Achievements

None
Pascal Presley
Suh? How's it goin? I'm Pascal Presley. Removing excess stuffing from pillows is my favorite hobby. I may need de-worming. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I like nibbling on most everything, but I'll bite if you want me to.
  • Purity 0%
  • Age 2 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTATACGAAAGCGTATCATCCATATGAGGACCA
T
T
A
T
A
C
G
A
A
A
G
C
G
T
A
T
C
A
T
C
C
A
T
A
T
G
A
G
G
A
C
C
A
Genes: FJ2OE7NCBA5

Composition

Yorkshire Terrier
9%
Border Collie
9%
Pug
9%
Corgi
9%
Shiba Inu
9%
German Shepard
9%
Pitbull terrier
9%
Schnauzer
9%
St. Bernard
9%
Dachshund
9%
Labrador
9%

Current Energy

Vitality -16 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Border Collie
Legs Pug
Front Legs Corgi
Head Shiba Inu
Ears German Shepard
Snout Pitbull terrier
Mouth Schnauzer
Nose St. Bernard
Eyes Dachshund
Color Labrador

Parents

No Children