Slater Shasta Bitcoin Dog - Mix of Schnauzer, Labrador BK, Corgi, Grey Wolf, Shiba Inu, German Shepard and French Bulldog

Achievements

None
Slater Shasta
I love unconditionally. My favorite chews are underwear and rawhide...the rawhide lasts longer. I have a crush on the Grumpy cat. I don't like to be ignored. I'd like to find a dawg to hang with, no pressure. We can always make puppies later.
  • Purity 12%
  • Age 2 months
  • Racing Exp 0
  • Schnauzer 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ATAATAGCAAGCCCCATAGTATCAGCAGCACGA
A
T
A
A
T
A
G
C
A
A
G
C
C
C
C
A
T
A
G
T
A
T
C
A
G
C
A
G
C
A
C
G
A
Genes: CC6OLCE7669

Composition

Schnauzer
27%
Labrador BK
27%
Corgi
9%
Grey Wolf
9%
Shiba Inu
9%
German Shepard
9%
French Bulldog
9%

Current Energy

Vitality +5 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Labrador BK
Front Legs Corgi
Head Grey Wolf
Ears Schnauzer
Snout Shiba Inu
Mouth German Shepard
Nose Labrador BK
Eyes Labrador BK
Color French Bulldog