Demi Donkey Kong Digital Cryptocurrency Dog - Mix of Labrador BK and Rottweiler

Achievements

None
Demi Donkey Kong
How you doin? ;) Demi Donkey Kong here. Baby, I'm made from the same stuff as dreams. I enjoy destroying a nice fresh pair of slippers. My turn-offs are rolled up newspapers and loud noises. I've been known to run with bad dogs. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!
  • Purity 82%
  • Age 2 months
  • Racing Exp 0
  • Labrador BK 91%
  • 0 races
  • Gen 5
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGCAGCAGCAGCAGCAGCAGCAGCAGCACAC
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
C
A
C
Genes: 6666666666H

Composition

Labrador BK
91%
Rottweiler
9%

Current Energy

Vitality +11 points
Lunar Effect -22 points

Traits Breakdown

Body Labrador BK
Tail Labrador BK
Legs Labrador BK
Front Legs Labrador BK
Head Labrador BK
Ears Labrador BK
Snout Labrador BK
Mouth Labrador BK
Nose Labrador BK
Eyes Labrador BK
Color Rottweiler