Boo Big Foot Crypto Dog - Pure German Shepard

Achievements

None
Boo Big Foot
I hate it when my human runs out of poop-bags. How embarrassing! Hope you like the smell of wet fur, because I'll jump into any water I see! I've had my nose rubbed in 'it' more than once. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers.
  • Purity 100%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 100%
  • 0 races
  • Gen 14
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality +5 points
Lunar Effect -24 points

Traits Breakdown

Traits 100% Purebred German Shepard