Bunky Bart Crypto Dog - Mix of German Shepard, Husky, Yorkshire Terrier, Shiba Inu, Labrador and Labrador BK

Achievements

None
Bunky Bart
I run on the information superhighway and haven't been hit by a car yet. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I'll outrun you for the ball if I can...that's just how I roll. I really dislike stinky flea collars.
  • Purity 29%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 55%
  • 0 races
  • Gen 6
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATTATCATCATCATCATCAGTACCATCAGCA
A
C
A
T
T
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
G
T
A
C
C
A
T
C
A
G
C
A
Genes: 4F77777E576

Composition

German Shepard
55%
Husky
9%
Yorkshire Terrier
9%
Shiba Inu
9%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality +13 points
Lunar Effect -22 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth Shiba Inu
Nose Labrador
Eyes German Shepard
Color Labrador BK