Juliette Johnny Cage Bitcoin Dog - Mix of German Shepard, St. Bernard, Husky, Yorkshire Terrier, Grey Wolf, Poodle and Labrador BK

Achievements

None
Juliette Johnny Cage
How do you do? I'm Juliette Johnny Cage. I love fetching anything my human throws! My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right?
  • Purity 14%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATTATCATCACCCTCATCATGAGACTGAGCA
A
C
A
T
T
A
T
C
A
T
C
A
C
C
C
T
C
A
T
C
A
T
G
A
G
A
C
T
G
A
G
C
A
Genes: 4F77L77BIB6

Composition

German Shepard
36%
St. Bernard
18%
Husky
9%
Yorkshire Terrier
9%
Grey Wolf
9%
Poodle
9%
Labrador BK
9%

Current Energy

Vitality +18 points
Lunar Effect -2 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs German Shepard
Front Legs German Shepard
Head Grey Wolf
Ears German Shepard
Snout German Shepard
Mouth St. Bernard
Nose Poodle
Eyes St. Bernard
Color Labrador BK