Joey Jewel Crypto Game Dog - Mix of German Shepard, Boxer, Schnauzer, Rottweiler, French Bulldog, Yorkshire Terrier and Maltese

Achievements

None
Joey Jewel
Air Bud is definitely my favorite movie. What a role model! I like nibbling on most everything, but I'll bite if you want me to. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! I've been solitary dog...looking for someone worth changing over.
  • Purity 12%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACTCAATACACTCATCACGATCATTAAACACC
A
A
C
T
C
A
A
T
A
C
A
C
T
C
A
T
C
A
C
G
A
T
C
A
T
T
A
A
A
C
A
C
C
Genes: G7CH7797FGK

Composition

German Shepard
36%
Boxer
18%
Schnauzer
9%
Rottweiler
9%
French Bulldog
9%
Yorkshire Terrier
9%
Maltese
9%

Current Energy

Vitality -6 points
Lunar Effect -14 points

Traits Breakdown

Body Boxer
Tail German Shepard
Legs Schnauzer
Front Legs Rottweiler
Head German Shepard
Ears German Shepard
Snout French Bulldog
Mouth German Shepard
Nose Yorkshire Terrier
Eyes Boxer
Color Maltese