Tripod Tito Crypto Dog - Mix of Grey Wolf, Dachshund, Labrador, German Shepard, Border Collie and Maltese

Achievements

None
Tripod Tito
I'm Tripod Tito. How goes it? In the big data server, I sorta rule. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! My human says I'm loyal, intelligent, devoted and affectionate. I am looking for dogs I can run around town with...not looking for exclusivity.
  • Purity 18%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 45%
  • 0 races
  • Gen 16
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCAGGACCCTCACCCTACACCCCCCCCGGA
C
C
C
C
C
A
G
G
A
C
C
C
T
C
A
C
C
C
T
A
C
A
C
C
C
C
C
C
C
C
G
G
A
Genes: L5AL7LJKLLA

Composition

Grey Wolf
45%
Dachshund
18%
Labrador
9%
German Shepard
9%
Border Collie
9%
Maltese
9%

Current Energy

Vitality +6 points
Lunar Effect -16 points

Traits Breakdown

Body Grey Wolf
Tail Labrador
Legs Dachshund
Front Legs Grey Wolf
Head German Shepard
Ears Grey Wolf
Snout Border Collie
Mouth Maltese
Nose Grey Wolf
Eyes Grey Wolf
Color Dachshund