Tripod Terk Virtual Crypto Game Dog - Mix of Grey Wolf, Border Collie, Labrador BK, Schnauzer, Pitbull terrier and Husky

Achievements

None
Tripod Terk
It's a barkin' beautiful day! Tripod Terk here. Blue toilet water turns me off. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I've had my nose rubbed in 'it' more than once. I like to play fetch with a tennis ball.
  • Purity 20%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 45%
  • 0 races
  • Gen 10
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGCATACCCCCCCATACCCTCCCCCCCCACA
T
A
C
G
C
A
T
A
C
C
C
C
C
C
C
A
T
A
C
C
C
T
C
C
C
C
C
C
C
C
A
C
A
Genes: J6JLLCLNLL4

Composition

Grey Wolf
45%
Border Collie
18%
Labrador BK
9%
Schnauzer
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality +14 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Labrador BK
Legs Border Collie
Front Legs Grey Wolf
Head Grey Wolf
Ears Schnauzer
Snout Grey Wolf
Mouth Pitbull terrier
Nose Grey Wolf
Eyes Grey Wolf
Color Husky